ANG Genome Browser

General Features:

---

The main features are, it supports many standard file formats such as GFF, BED, GTF, FASTA, VCF, BAM and it can be integrated with other browsers or tools for analysis of genome.

• Explore your genome with ANG Genome Browser.
• Standalone Genome Browser.
• It has scrolling and zooming.
• Relatively simple to operate.
• It can be integrated with other browser or tools for analysis of genome.
• It supports many standard file formats such as GFF (UCSC), BED, GTF, FASTA, VCF, BAM.
• It has ability to display data directly from BAM and VCF file, no preprocessing is necessary.
• Comparative results from multiple VCF files.

Supported file format:

Visualization features:

ANG Genome Browser provides the efficient way to visualize genomic data. In addition to that, it is easy to navigate quickly and efficiently.

1. Available Tracks

ANG Genome Browser has a simple interface where you can see loaded tracks
on left side and features of tracks on right side.

1.1 Reference Genome

The reference genome file should be in fasta or multi fasta format. It allows any file extensions but file should have FASTA format. Both single-entry and multiple-entry Fasta files are supported. Multiple reference genome files can be uploaded but only one genome can be viewed at a time. Multiple selection of reference genome is not allowed.
For eg. >chr1 or >chr1 Homo sapiens
>chr1
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTCTC TGACAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGG

After uploading of reference genome, user can use following options :

Forward & Reverse Strand:

Select option show forward /reverse strand to view forward/reverse strand. A user needs to select a particular option as per interest.

Change Base Color :

Users can change base color as per their choice. A Customized option can be used to select colors for bases ATGC and default option will keep default colors.

The nucleotide's color by default option.

The nuclotides are shown below by using default color setting.

The nucleotide's color by Customized option. Users can change the base colors as per their choice.

The nuclotides are shown below by using customized color setting.

Retrieve Sequence :

A user can retrieve sequence of region of interest by specifying the position and chromosome number. The chromosome dropdown box will give a choice for selection of chromosome numbers. The retrieved sequence will be in fasta format.

Save file in a particular folder.

1.2 Annotations

In annotation, there are three files format which can be uploaded here. Gene transfer format (GTF) file should be tab separated, contains one line per feature. GTF borrows from GFF, but has additional structure. GFF has several versions, the most recent of which is GFF3. Structure is as GFF so the fields are:

<seqname> <source> <feature> <start> <end> <score> <strand> <frame> [attributes] [comments]

ANG Genome Browser takes UCSC gtf format. These files contain information about features such as exon, CDS , start codon. It also has start & end, frame, strand, attribute.

Image of .gtf file format

GTF Track

After loading gtf file, if a user takes a cursor on any strand, it gives information about that strand. It shows ID, start & stop codon positions. The arrows on the strand tells you about the orientation of the strands. The arrow -> is the forward strand & arrow <- is the reverse strand. If a user clicks on any strand, it gives transcript details such as transcript ID, chromosome, strand, total number of exons & CDS. It also shows nucleotide sequence as well as its translated protein sequence. There is an option for selection of genetic code.

BED Track

The BED file has 7 fields, which give the information about chrom, ExonStart and ExonEnd or CDSStart and CDSEnd,type Exon or CDS, strand, id and description. Example of .bed file format

After loading bed track, CDS are shown in golden color and exons present in CDS are shown in green color. The arrow indicates the type of strand i.e. forward or reverse. The arrow -> indicates forward strand and <- indicates reverse strand.

GTF Track

After loading gff file, if a user takes a cursor on any strand, it gives information about that strand. It shows Chromosome , Gene or Exon or CDS start & Gene or Exon or CDS End positions. The arrows on the strand tells you about the orientation of the strands. The arrow -> is the forward strand & arrow <- is the reverse strand.

1.3 BAM

BAM is a compressed binary version of sequence alignment map (SAM) format. Multiple BAM files can be loaded, viewed and mapped at a time on reference genome.

i. BAM Track (Default View : Hide Bases)

ii. BAM Track (Show Bases)

After loading of BAM file, there are following options which a user can use.

1.3 VCF Track

Variant call format (VCF) is a flexible and an extendable format for variation data. The variation can be single nucleotide variants, insertions,deletions, copy number and structural variants.

The vcf table provides information about chromosome, its position & variation at that position. Each line of the data table containing information about a position in the genome. Multiple vcf files can be uploaded, however only one file can be viewed at a time. If you select any one of the vcf files then data table will be displayed.

The data table displays the data in tabular format, with rows and columns. It has an options such as search and sort. The variation data table provides a spreadsheet-like summary of all variants in the variation module’s current display range. Single clicking on row will center the main track display on the position of that variant.

2. Chromosome number & Position field

Chromosome and its position will be given in the navigation bar. The chromosome contains dropdown box which has list of chromosomes. A user can select chromosome number as well as position of region of interest.

3. Navigation buttons

There are two navigation buttons at the top of right side of navigation bar. Pan Left and Pan Right shift the visible location left or right on the screen.

4. Zooming

Zoom in and out can be done by clicking zooming buttons in the navigation bar.

5. Genome slider

User can go to a particular position easily by clicking and dragging within the genome slider.

6. Genome ruler

Underneath the genome slider is the ruler, which indicates the current viewable range in the coordinate space of the current chromosome.